|
|
|
题名
|
作者
|
年代
|
出处
|
被引量
|
| 1 | Mutation profile and its correlation with clinicopathology in Chinese hepatocellular carcinoma patients显示文摘Background:Hepatocellular carcinoma(HCC)is one of the most common causes of cancer worldwide.Although many studies have focused on oncogene characteristics,the genomic landscape of Chinese HCC patients has not been fully clarified.Methods:A total of 165 HCC patients,including 146 males and 19 females,were enrolled.The median age was 55 years(range,27-78 years).Corresponding clinical and pathological information was collected for further analysis.A total of 168 tumor tissues from these patients were selected for next-generation sequencing(NGS)-based 450 panel gene sequencing.Genomic alterations including single nucleotide variations(SNV),short and long insertions and deletions(InDels),copy number variations,and gene rearrangements were analyzed.Tumor mutational burden(TMB)was measured by an algorithm developed in-house.The top quartile of HCC was classified as TMB high.Results:A total of 1,004 genomic alterations were detected from 258 genes in 168 HCC tissues.TMB values were identified in 160 HCC specimens,with a median TMB of 5.4 Muts/Mb(range,0-28.4 Muts/Mb)and a 75%TMB of 7.7 Muts/Mb.The most commonly mutated genes were TP53,TERT,CTNNB1,AXIN1,RB1,TSC2,CCND1,ARID1A,and FGF19.SNV was the most common mutation type and C:G>T:A and guanine transformation were the most common SNVs.Compared to wild-type patients,the proportion of Edmondson grade III-IV and microvascular invasion was significantly higher in TP53 mutated patients(P<0.05).The proportion of tumors invading the hepatic capsule was significantly higher in TERT mutated patients(P<0.05).The proportion of Edmondson grade I-II,alpha fetoprotein(AFP)<25μmg/L,and those without a history of hepatitis B was significantly higher in CTNNB1 mutated patients(P<0.05).CTNNB1 mutations were associated with TMB high in HCC patients(P<0.05).Based on correlation analysis,the mutation of TP53 was independently correlated with microvascular invasion(P=0.002,OR=3.096)and Edmondson grade III-IV(P=0.008,OR=2.613).The mutation of TERT was independently correlated with tumor invasion of the liver capsule(P=0.001,OR=3.030),and the mutation of CTNNB1 was independently correlated with AFP(<25μmg/L)(P=0.009,OR=3.414).Conclusions:The most frequently mutated genes of HCC patients in China were TP53,TERT,and CTNNB1,which mainly lead to the occurrence and development of HCC by regulating the P53 pathway,Wnt pathway,and telomere repair pathway.There were more patients with microvascular invasion and Edmondson III-IV grade in TP53 mutated patients and more patients with hepatic capsule invasion in TERT mutated patients,while in CTNNB1 mutated patients,there were more patients with Edmondson I-II grade,AFP<25μmg/L,and a non-hepatitis B background.Also,the TMB values were significantly higher in CTNNB1 mutated patients than in wild type patients. | Shuo Wang Huasheng Shi Tao Liu Manjiang Li Sanshun Zhou Xuan Qiu Zusen Wang Weiyu Hu Weidong Guo Xiaoqian Chen Honglin Guo Xiaoliang Shi Junping Shi Yunjin Zang Jingyu Cao Liqun Wu | 2021 | Hepatobiliary Surgery and Nutrition2021,10,2: | 8 |
| 2 | Roxithromycin attenuates bleomycin-induced pulmonary fibrosis by targeting senescent cells显示文摘Idiopathic pulmonary fibrosis(IPF)is an aging-associated disease with a poor prognosis.Emerging evidence has revealed that targeting senescent cells may be a potential treatment for IPF.In this study,we aimed to explore whether roxithromycin(RXM)can improve lung fibrosis by targeting senescent cells.First,we confirmed the ability of RXM to selectively kill senescent cells by inducing apoptosis and inhibiting the expression of senescence-associated secretory phenotype(SASP)factors,suggesting the potential role of RXM as a“senolytic”and“senomorphic”drug.Next,we observed that TGF-β-and senescent cell-induced lung fibroblast activation was inhibited by RXM treatment,which prompted us to further investigate its effect in vivo.In a mouse model of bleomycin(BLM)-induced pulmonary fibrosis,RXM was shown to attenuate lung injury,inflammation,and fibrosis.Furthermore,the senescent phenotype of lung tissues induced by BLM was significantly diminished after RXM administration,indicating the potential of RXM as an antifibrotic and antisenescent agent.Interestingly,NADPH oxidase 4(NOX4),implicated in lung fibrosis and cell senescence,was shown to be inhibited by RXM treatments.The antifibroblast activation and antisenescent effects of RXM were abolished in NOX4 knockdown cells,demonstrating that RXM may ameliorate BLM-induced pulmonary fibrosis by targeting senescent cells mediated by the NOX4 pathway.Collectively,these data demonstrated that RXM may be a potential clinical agent for IPF and further supported the notion that targeting cellular senescence is a promising treatment for progressive age-related disease. | Xuan Zhang Ying Dong Wan-chen Li Bi-xi Tang Jia Li Yi Zang | 2021 | Acta Pharmacologica Sinica2021,42,12: | 3 |
| 3 | ZCCHC3 modulates TLR3-mediated signaling by promoting recruitment of TRIF to TLR3显示文摘Toll-like receptor 3(TLR3)-mediated signaling is important for host defense against RNA virus.Upon viral RNA stimulation,toll and interleukin-1 receptor domain-containing adaptor inducing IFN-p(TRIF)is recruited to TLR3 and then undergoes oligomerization,which is required for the recruitment of downstream molecules to transmit signals.Here,we identified zinc finger CCHC-type containing 3(ZCCHC3)as a positive regulator of TLR3-mediated signaling.Overexpression of ZCCHC3 promoted transcription of downstream antiviral genes stimulated by the synthetic TLR3 ligand poly(I:C).ZCCHC3-deficiency markedly inhibited TLR3-but not TLR4-mediated induction of type I interferons(IFNs)and proinflammatory cytokines.Zcc/7c3-/-mice were more resistant to poly(l:C)-but not lipopolysaccharide-induced inflammatory death.Mechanistically,ZCCHC3 promoted recruitment of TRIF to TLR3 after poly(l:C)stimulation.Our findings reveal that ZCCHC3 plays an important role in TLR3-mediated innate immune response by promoting the recruitment of TRIF to TLR3 after ligand stimulation. | Ru Zang Huan Lian Xuan Zhong Qing Yang Hong-Bing Shu | 2020 | Journal of Molecular Cell Biology2020,12,4: | 3 |
| 4 | Molecular basis for CENP-N recognition of CENP-A nucleosome on the human kinetochore显示文摘 | Tian Tian Xiaorun Li Yingying Liu Chengliang Wang Xing Liu Guoqiang Bi Xuan Zhang Xuebiao Yao Z Hong Zhou Jianye Zang | 2018 | Cell Research2018,28,3: | 2 |
| 5 | A Zigbee - based smart home system : An energy - saving method显示文摘 | Zang Xuan Ying Sun Li Kejun | | 0,,148: | 1 |
| 6 | The clinical implications of increased cyclophilin A levels in patients with acute coronary syndromes显示文摘 | Jinchuan Yan Xuan Zang Rui Chen Wei Yuan Jie Gong Cuiping Wang Ying Li | 2012 | Clinica Chimica Acta (-)2012,,7: | 1 |
| 7 | Phosphorylation of PHF2 by AMPK releases the repressive H3K9me2 and inhibits cancer metastasis显示文摘Epithelial to mesenchymal transition (EMT) plays a crucial role in cancer metastasis, accompanied with vast epigenetic changes.AMP-activated protein kinase (AMPK), a cellular energy sensor, plays regulatory roles in multiple biological processes. Although afew studies have shed light on AMPK regulating cancer metastasis, the inside epigenetic mechanisms remain unknown. Herein weshow that AMPK activation by metformin relieves the repressive H3K9me2-mediated silencing of epithelial genes (e.g., CDH1)during EMT processes and inhibits lung cancer metastasis. PHF2, a H3K9me2 demethylase, was identified to interact with AMPKα2.Genetic deletion of PHF2 aggravates lung cancer metastasis and abolishes the H3K9me2 downregulation and anti-metastasis effectof metformin. Mechanistically, AMPK phosphorylates PHF2 at S655 site, enhancing PHF2 demethylation activity and triggering thetranscription of CDH1. Furthermore, the PHF2-S655E mutant that mimics AMPK-mediated phosphorylation status further reducesH3K9me2 and suppresses lung cancer metastasis, while PHF2-S655A mutant presents opposite phenotype and reverses the antimetastasiseffect of metformin. PHF2-S655 phosphorylation strikingly reduces in lung cancer patients and the higherphosphorylation level predicts better survival. Altogether, we reveal the mechanism of AMPK inhibiting lung cancer metastasis viaPHF2 mediated H3K9me2 demethylation, thereby promoting the clinical application of metformin and highlighting PHF2 as thepotential epigenetic target in cancer metastasis. | Ying Dong Hao Hu Xuan Zhang Yunkai Zhang Xin Sun Hanlin Wang Weijuan Kan Min-jia Tan Hong Shi Yi Zang Jia Li | 2023 | Signal Transduction and Targeted Therapy2023,8,4: | 1 |
| 8 | A Zigbee-based smart home system:An energy- saving method显示文摘 | Zang Xuan Ying Sun Li Kejun | 2011 | Advanced Materials Research2011,,: | 1 |
| 9 | The discovery of colchicine-SAHA hybrids as a new class of antitumor agents显示文摘 | Xuan Zhang Jie Zhang Linjiang Tong Yu Luo Mingbo Su Yi Zang Jia Li Wei Lu Yi Chen | 2013 | Bioorganic & Medicinal Chemistry2013,,11: | 1 |
| 10 | miRNA - 1207 -5p is associ- ated with cancer progression by targeting stomatin - like protein 2 in esophagealcarcinoma显示文摘 | Yang X Zang W Xuan X | 2015 | Int J Oncol2015,46,5: | 1 |
| 11 | Hourly classified identifications: the annual relative variation rates (RVRs) are approximate in different cities for the same building with the same shading coefficient 显示文摘 | J LONG En - shen Zang Zi - xuan | 2005 | Building and Environment2005,40,4: | 1 |
| 12 | Dynamic phosphorylation of CENP-N by CDK1 guides accurate chromosome segregation in mitosis显示文摘In mitosis,accurate chromosome segregation depends on the kinetochore,a supermolecular machinery that couples dynamic spin-dle microtubules to centromeric chromatin.However,the structure–activity relationship of the constitutive centromere-associated network(CCAN)during mitosis remains uncharacterized.Building on our recent cryo-electron microscopic analyses of human CCAN structure,we investigated how dynamic phosphorylation of human CENP-N regulates accurate chromosome segregation.Our mass spectrometric analyses revealed mitotic phosphorylation of CENP-N by CDK1,which modulates the CENP-L–CENP-N interaction for accurate chromosome segregation and CCAN organization.Perturbation of CENP-N phosphorylation is shown to prevent proper chromosome alignment and activate the spindle assembly checkpoint.These analyses provide mechanistic insight into a previously undefined link between the centromere–kinetochore network and accurate chromosome segregation. | Ran Liu Zhen Dou Tian Tian Xinjiao Gao Lili Chen Xiao Yuan Chunyue Wang Jiahe Hao Ping Gui McKay Mullen Felix Aikhionbare Liwen Niu Guoqiang Bi Peng Zou Xuan Zhang Chuanhai Fu Xuebiao Yao Jianye Zang Xing Liu | 2023 | Journal of Molecular Cell Biology2023,15,6: | 0 |
| 13 | Spatial transcriptome unveils a discontinuous inflammatory pattern in proficient mismatch repair colorectal adenocarcinoma显示文摘The preexistence of immune cells in the tumor microenvironment substantiates the efficacy of immunotherapy in cancer patients.Although the complex intratumoral immune heterogeneity has been extensively studied in single cell resolution,hi-res spatial investigations are limited.In this study,we performed a spatial transcriptome analysis of 4 colorectal adenocarcinoma specimens and 2 paired distant normal specimens to identify the molecular pattern involved in a discontinuous inflammatory response in pathologically annotated cancer regions.Based on the location of spatially varied gene expression,we unmasked the spatially-varied immune ecosystem and identified the locoregional“warmed-up”immune response in predefined“cold”tumor with substantial infiltration of immune components.This“warmed-up”immune profile was found to be associated with the in-situ copy number variance and the tissue remodeling process.Further,“warmed-up”signature genes indicated improved overall survival in CRC patients obtained from TCGA database. | Rongxin Zhang Yu Feng Wenjuan Ma Yanying Guo Mei Luo Young Li Yupeng Zang Xuan Dong Shixun Lu Qiang Guo Qumiao Xu Huanyi Chen Yijian Li Longqi Liu Ao Chen Gong Chen Xun Xu | 2023 | Fundamental Research2023,3,4: | 0 |
| 14 | Sulfonate-Functionalized Polyoxovanadate-Based Metal-Organic Polyhedra for Enhanced Proton Conduction via the Synergy of Linker and Metal Cluster Vertex显示文摘Metal-organic polyhedra(MOPs)have emerged as novel porous platforms for proton conduction,however,the concerted employment of both linker and metal cluster vertex is rarely applied for the fabrication of MOPs-based high conducting materials.Herein we report the synthesis of sulfonate-functionalized polyoxovanadate-based MOPs for enhanced proton conduction via the synergistic effect from linker and metal cluster node.MOPs 1 and 2 exhibit octahedral cage configuration constructed from{V_(5)O_(9)Cl}vertex and 5-sulfoisophthalate linker.Owing to the ordered packing of octahedral cages along three axes,3D interpenetrated open channels that are lined with high-density sulfonates are thus formed within 2.Coupled with the proton-conductive{V_(5)O_(9)Cl}vertexs as well as protonated counterions,an extensive H-bonded network is therefore generated for facile proton transfer.2 exhibits high proton conductivity of 3.02×10^(-2)S cm^(-1)at 65℃under 90%RH,recording the highest value for MOPs pellet sample.This value is enhanced~1order of magnitude compared with that of carboxylate-functionalized analogue 3,clearly illustrating the advantage of combining linker and metal cluster node for enhanced proton conduction.This work will further promote the exploitation of high proton conductive MOPs-based materials by the synergy design strategy. | Yu Zhang Shan-Shan Liu Bo Li Hanqi You Longxi Zhang Zhenyi Zhang Hong-Ying Zang Qi Zheng Weimin Xuan | 2022 | Chinese Journal of Structural Chemistry2022,41,8: | 0 |
| 15 | Discovery of a novel DDRs kinase inhibitor XBLJ-13 for the treatment of idiopathic pulmonary fibrosis显示文摘Idiopathic pulmonary fibrosis(IPF)is a chronic fatal lung disease characterized by destruction of lung parenchyma and deposition of extracellular matrix in interstitial and alveolar spaces.But known drugs for IPF are far from meeting clinical demands,validation of drug targets against pulmonary fibrosis is in urgent demand.Tyrosine kinase receptor DDRs has been considered as a potential therapeutic target for pulmonary fibrosis due to its pathological collagen binding property and the roles in regulating extracellular matrix remodeling.In this study we designed and synthesized a new indazole derivative XBLJ-13,and identified XBLJ-13 as a highly specific and potent DDRs inhibitor with anti-inflammation and anti-fibrosis activities.We first demonstrated that DDR1/2 was highly expressed in the lung tissues of IPF patients.Then we showed that XBLJ-13 potently inhibited DDR1 and DDR2 kinases with IC50 values of 17.18 nM and 15.13 nM,respectively.Among a panel of 34 kinases tested,XBLJ-13 displayed relatively high selectivity for DDRs with minimal inhibitory effect on PDGFR family and FGFR1,as well as Abl kinase that had high homology with DDRs.Extensive profiling of XBLJ-13 revealed that the new inhibitor had much lower toxicity than nintedanib and better pharmacokinetic properties in mice.Furthermore,pharmacodynamic evaluation conducted in bleomycin-induced pulmonary fibrosis mice showed that administration of XBLJ-13(30,60,90 mg·kg^(−1)·d^(−1),i.g.)for 12 days significantly and dose-dependently ameliorated lung inflammation and fibrosis.Together,this study confirms that DDRs kinase is a potential target for PF,Particularly,compound XBLJ-13 is a highly potent and specific DDRs inhibitor,along with good pharmacokinetics profiles,and preferable in vivo efficacy,suggesting that it is a potential candidate for the treatment of PF. | Ying Dong Bi-xi Tang Qi Wang Li-wei Zhou Cong Li Xuan Zhang Dan-dan Sun Xin Sun Xue-mei Zhang Bing Xiong Jia Li Hong Shi Dan-qi Chen Yi Zang | 2022 | Acta Pharmacologica Sinica2022,43,7: | 0 |
| 16 | Correction to: SNX8 modulates the innate immune response to RNA viruses by regulating the aggregation of VISA显示文摘In the version of this article initially published,three unintended errors were made during manuscript preparation.(1)The caption of Fig 4a was incorrect,and the correct statement is‘Effects of SNX8-deficiency on virus-induced death of mice.Mice were infected intraperitoneally(i.p.)with VSV at 5×107 pfu per mouse(n=10 for each genotype)or EMCV at 5×106 pfu per mouse(n=10 for Snx8+/+,n=11 for Snx8−/−).Mouse survival was observed and recorded for 12 days.’(2)Fig 2a and Fig 2e were represented erroneously.The correct Fig 2 is shown below.(3)Typos were found in the description of the qPCR primers for GAPDH and IFNB1 in the Material and Method section,the correct primers are'GAPDH GAGTCAACGGATTTGGTCGT(forward)and GACAAGCTTCCCGTTCTCAG(reverse);IFNB1 TTGTTGAGAACCTC CTGGCT(forward)and TGACTATGGTCCAGGCACAG(reverse)'.The results and conclusions are not affected. | Wei Guo Jin Wei Xuan Zhong Ru Zang Huan Lian Ming-Ming Hu Shu Li Hong-Bing Shu Qing Yang | 2021 | Cellular & Molecular Immunology2021,18,6: | 0 |
| 17 | Differential regulation of JAK1 expression by ETS1 associated with predisposition to primary biliary cholangitis显示文摘Primary biliary cholangitis(PBC)is an autoimmune liver disease characterized by the destruction of intrahepatic small bile ducts and progressive cholestasis,eventually leading to liver cirrhosis and hepatic failure without appropriate treatment(Terziroli Beretta-Piccoli et al.,2019). | Peng Jiang Chan Wang Mingming Zhang Ye Tian Weifeng Zhao Junyi Xin Yexi Huang Zhibin Zhao Wenjuan Sun Jie Long Ruqi Tang Fang Qiu Xingjuan Shi Yi Zhao Li Zhu Na Dai Lei Liu Xudong Wu Jinshan Nie Bo Jiang Youlin Shao Yueqiu Gao Jianjiang Yu Zhigang Hu Zhidong Zang Yuhua Gong Yaping Dai Lan Wang Ningling Ding Ping Xu Sufang Chen Lu Wang Jing Xu Luyao Zhang Junyan Hong Ruonan Qian Hu Li Xuan Jiang Congwei Chen Wenyan Tian Jian Wu Yuzhang Jiang Chongxu Han Kui Zhang Hong Qiu Li Li Hong Fan Liming Chen Jianqiong Zhang Zhongsheng Sun Xiao Han Zhenhua Dai Erguang Li M.Eric Gershwin Zhexiong Lian Xiong Ma Michael F.Seldin Weichang Chen Meilin Wang Xiangdong Liu | 2023 | Journal of Genetics and Genomics2023,50,10: | 0 |